Journal: Molecular Cell

Article Title: Modularity and diversity of target selectors in Tn7 transposons

doi: 10.1016/j.molcel.2023.05.013

Figure Lengend Snippet: TnsF targets a conserved Walker B motif in comM (A) Schematic of the locus architecture of Zoogloea sp. LCSB751 target selector based on tyrosine (Y) recombinase transposon (ZooTsy). (B) Genetic requirement of YRec, HTH, and TnsF on ZooTsy transposition activity, as assayed by quantification of upstream-end1 junction formation by ddPCR. Deleted genes are indicated by a dashed outline. See also Figure S5 H. (C) ddPCR experiments showing the insertion frequency of AjTn6022 into pTarget with a 200 bp-fragment of comM (left) and E. coli endogenous comM (right) in the absence of TnsF and/or presence of the pTarget(AjTn6022). pSC101 donor was used. (D) ddPCR experiments showing the insertion frequency of ZooTsy into pTarget with a 200 bp-fragment of comM (left) and E. coli endogenous comM (right) in the absence of TnsF and/or presence of the pTarget(ZooTsy). pSC101 donor was used. (E) Electrophoretic mobility shift assay (EMSA) to assess the interaction between a 200-bp or 200-nt fragment of AjcomM and purified AjTn6022-TnsF. (F) EMSA to assess the interaction between a 200-bp or 200-nt fragment of ZoocomM and purified ZooTsy-TnsF_Y584F. (G) Insertion sites of Tn6022 and ZooTsy on E. coli endogenous comM and comM of their respective hosts used in the pTarget. ComM protein sequences (translated comM ) are shown below the nucleotide sequence. The pink rectangle indicates the genomic location of the Walker B of the AAA ATPase encoded by comM ; the red rectangle shows the probable hot spot binding region of both TnsFs. (H) Model of TnsF target selection and insertions for Tn6022 and Tsy. ddPCR experiments were performed with three biological replicates. All data points are shown with an error bar showing standard deviation, and statistical significance was assessed by t test. ∗ p < 0.05; ∗∗∗ p < 0.001; ∗∗∗∗ p < 0.0001; n.s., not significant. See also Figures S5–S7 .

Article Snippet: CTTTCCCTACACGACGCTCTTCCGA TCTgtgtgcttctcaaatgcctgaggtttc , Genewiz , NGS ZooTsy-comM downstream primer.

Techniques: Activity Assay, Electrophoretic Mobility Shift Assay, Purification, Sequencing, Binding Assay, Selection, Standard Deviation

Journal: Molecular Cell

Article Title: Modularity and diversity of target selectors in Tn7 transposons

doi: 10.1016/j.molcel.2023.05.013

Figure Lengend Snippet:

Article Snippet: CTTTCCCTACACGACGCTCTTCCGA TCTgtgtgcttctcaaatgcctgaggtttc , Genewiz , NGS ZooTsy-comM downstream primer.

Techniques: Recombinant, Staining, DNA Purification, Purification, Plasmid Preparation, Mutagenesis, Ligation, Sequencing, Protease Inhibitor, Software

Journal: Metabolites

Article Title: Alfalfa Xeno-miR168b Target CPT1A to Regulate Milk Fat Synthesis in Bovine Mammary Epithelial Cells

doi: 10.3390/metabo13010076

Figure Lengend Snippet: Primer sequences of the genes.

Article Snippet: The sequences for si CPT1A were sense (5′-3′): GGGAGGAAAUCAAACCGAUTT and antisense (5′-3′): AUCGGUUUGAUUUCCUCCCTT. miRNA mimics and a miRNA negative control (NC) were purchased from Guangzhou RiboBio Co., Ltd. (RiboBio, Guangzhou, China), and si CPT1A and si-NC were purchased from Shanghai Sangon Biotech Co., Ltd. (Sangon, Shanghai, China).

Techniques: Sequencing

Journal: Metabolites

Article Title: Alfalfa Xeno-miR168b Target CPT1A to Regulate Milk Fat Synthesis in Bovine Mammary Epithelial Cells

doi: 10.3390/metabo13010076

Figure Lengend Snippet: Xeno-miR168b regulated CPT1A expression. Data are given as the mean ± SD for n = 3/group. ** p < 0.01 was considered statistically significant. GO ( a ) and KEGG ( b ) functional enrichment analysis of predicted target genes, ( c ) the sequence of CPT1A 3′ UTR region and xeno-miR168b, ( d ) transfection efficiency of xeno-miR168b mimics, ( e ) expression level of CPT1A in 293T cells after the overexpression of xeno-miR168b, ( f ) dual-luciferase reporter assay for WT- CPT1A and MUT- CPT1A vectors in HEK-293T cells with or without xeno-miR168b overexpression, ( g ) gene expression level of AMPK and ACC , ( h ) WB analysis of AMPK and p-AMPK , and ( i ) quantitative analysis of protein bands in ( h ).

Article Snippet: The sequences for si CPT1A were sense (5′-3′): GGGAGGAAAUCAAACCGAUTT and antisense (5′-3′): AUCGGUUUGAUUUCCUCCCTT. miRNA mimics and a miRNA negative control (NC) were purchased from Guangzhou RiboBio Co., Ltd. (RiboBio, Guangzhou, China), and si CPT1A and si-NC were purchased from Shanghai Sangon Biotech Co., Ltd. (Sangon, Shanghai, China).

Techniques: Expressing, Functional Assay, Sequencing, Transfection, Over Expression, Luciferase, Reporter Assay, Gene Expression

Journal: Metabolites

Article Title: Alfalfa Xeno-miR168b Target CPT1A to Regulate Milk Fat Synthesis in Bovine Mammary Epithelial Cells

doi: 10.3390/metabo13010076

Figure Lengend Snippet: Effect of si CPT1A on lipid metabolism in BMECs. Data are given as the mean ± SD for n = 3/group. ** p < 0.01 were considered statistically significant. ( a ) Gene interference efficiency, ( b ) expression of genes downstream of CPT1A in CPT1A -silenced cells, ( c ) expression of lipid metabolism genes, and ( d ) lipid droplet formation in BMECs after CPT1A silencing.

Article Snippet: The sequences for si CPT1A were sense (5′-3′): GGGAGGAAAUCAAACCGAUTT and antisense (5′-3′): AUCGGUUUGAUUUCCUCCCTT. miRNA mimics and a miRNA negative control (NC) were purchased from Guangzhou RiboBio Co., Ltd. (RiboBio, Guangzhou, China), and si CPT1A and si-NC were purchased from Shanghai Sangon Biotech Co., Ltd. (Sangon, Shanghai, China).

Techniques: Expressing